Search SSR

Perfect Microsatellite
Compound Microsatellite
Microsatellite Cluster
Polymorphic Microsatellite

Perfect Microsatellite

Select Species: Select Chromosome Number:

Basic Search

Repeat Type : Location on genome :

Advanced Search

            Repeat Sequence :
                    Example: cgt
            Repeating Unit :         Example: 2

Postion range specific Search

From - to
Example: 10000, 30000(in basepairs)

Locus Specific Search

Locus Name : Exactly
Example: LbrM01_V2.0010 [Locus name Only, generalized keywords may complain error]

Compound Microsatellite

Select Species: Select Chromosome Number:

Search Query

Query Builder :
            Repeat Type :    Motif :    Repaeting Units :
[+] Help

Location on genome :        Length (greater than) :

Set Postion

From - to
Example: 10000, 30000(in basepairs)

Microsatellite Cluster

        Select Species:         Select Chromosome Number:

        Max. Interruption Value: e.g G(11)ATGACGATGGACATTGACCAGTCAG(A)5

        Location on genome :              Length :

Within Range : From     - to
            Example: 10000, 30000(in basepairs)

Polymorphic Microsatellite

Select reference species: Select Chromosome Number:

Species to consider * : [* edit species list to search against cusomized species.]

Repeat Type :

Mono-nucleotide	Di-nucleotide	Tri-nucleotide
Tetra-nucleotide	Penta-nucleotide	Hexa-nucleotide

Repeating Unit :

Location on genome :

Postion range :        From     - to
            Example: 10000, 30000(in basepairs)

Seach Microsatellites:

Perfect Microsatellite

Compound Microsatellite

Microsatellite Cluster

Polymorphic Microsatellite